Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6570943
End position: 6570966
Length: 24

DNA sequence
>NC_020895, from 6570943 to 6570966 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGCGGCGGCGTCGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6570187-6571011	Sequence	SHJGH_5793 - purine nucleoside phosphorylase (Protein is coded in complementary strand; from 6571011 to 6570187)