Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6646690
End position: 6646713
Length: 24

DNA sequence
>NC_020895, from 6646690 to 6646713 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGGGCGGGGGCGTGGGCCAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6642673-6647448	Sequence	SHJGH_5863 - Rhs protein (Protein is coded in complementary strand; from 6647448 to 6642673)