Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6964016
End position: 6964039
Length: 24

DNA sequence
>NC_020895, from 6964016 to 6964039 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGGCCGGGGCCGGAGCCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6960554-6964066	Sequence	SHJGH_6150 - alpha-ketoglutarate decarboxylase (Protein is coded in complementary strand; from 6964066 to 6960554)