Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7094109
End position: 7094132
Length: 24

DNA sequence
>NC_020895, from 7094109 to 7094132 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGAGGGAGAGGGGGAGGCGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7092770-7094155	Sequence	SHJGH_6265 - ABC transporter solute-binding protein (Protein is coded in complementary strand; from 7094155 to 7092770)