Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7136480
End position: 7136503
Length: 24

DNA sequence
>NC_020895, from 7136480 to 7136503 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGCCGTCGCGGTGGCCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7136425-7137012	Sequence	SHJGH_6296 - hypothetical protein (Protein is coded in complementary strand; from 7137012 to 7136425)