Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7215665
End position: 7215688
Length: 24

DNA sequence
>NC_020895, from 7215665 to 7215688 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCGAGGCCGCCGCCGAGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7215467-7216465	Sequence	SHJGH_6371 - ketol-acid reductioisomerase