Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7358126
End position: 7358149
Length: 24

DNA sequence
>NC_020895, from 7358126 to 7358149 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCGCCCCCGCGCCAGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7358055-7359179	Sequence	SHJGH_6500 - hypothetical protein (Protein is coded in complementary strand; from 7359179 to 7358055)