Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7395339
End position: 7395362
Length: 24

DNA sequence
>NC_020895, from 7395339 to 7395362 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCTCGCCCTCGGCCCCGACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7395104-7396594	Sequence	SHJGH_6533 - ATP/GTP binding protein