Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7669519
End position: 7669542
Length: 24

DNA sequence
>NC_020895, from 7669519 to 7669542 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GAGCGCGAGCGCCAGCGCGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7668458-7669693	Sequence	SHJGH_6758 - hypothetical protein (Protein is coded in complementary strand; from 7669693 to 7668458)