Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7671870
End position: 7671893
Length: 24

DNA sequence
>NC_020895, from 7671870 to 7671893 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGCGTCCGCGTGGGCGTGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7671248-7673200	Sequence	SHJGH_6760 - hypothetical protein (Protein is coded in complementary strand; from 7673200 to 7671248)