Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7692492
End position: 7692515
Length: 24

DNA sequence
>NC_020895, from 7692492 to 7692515 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGTCGCCGCCGCCGTCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7691303-7693024	Sequence	SHJGH_6773 - hypothetical protein (Protein is coded in complementary strand; from 7693024 to 7691303)