Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7882150
End position: 7882173
Length: 24

DNA sequence
>NC_020895, from 7882150 to 7882173 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCACCGGCGCCGCCACCGGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7882123-7884351	Sequence	SHJGH_6933 - integral membrane protein (Protein is coded in complementary strand; from 7884351 to 7882123)