Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7968098
End position: 7968121
Length: 24

DNA sequence
>NC_020895, from 7968098 to 7968121 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGGGCCGGCGGGCCGGCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7967646-7968725	Sequence	SHJGH_7009 - integral membrane protein