Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8002224
End position: 8002247
Length: 24

DNA sequence
>NC_020895, from 8002224 to 8002247 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCGCCGCGGTCGCCGCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8000651-8002297	Sequence	SHJGH_7041 - FG-GAP repeat domain protein (Protein is coded in complementary strand; from 8002297 to 8000651)