Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8136336
End position: 8136359
Length: 24

DNA sequence
>NC_020895, from 8136336 to 8136359 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGACGTCCACGTCCACGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8135331-8136395	Sequence	SHJGH_7169 - lipoate-protein ligase (Protein is coded in complementary strand; from 8136395 to 8135331)