Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8284415
End position: 8284438
Length: 24

DNA sequence
>NC_020895, from 8284415 to 8284438 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGAGGACGAGGACCAGGACGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8282926-8285772	Sequence	SHJGH_7310 - hypothetical protein (Protein is coded in complementary strand; from 8285772 to 8282926)