Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8776663
End position: 8776686
Length: 24

DNA sequence
>NC_020895, from 8776663 to 8776686 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGCTCCAGCGCAAGCTCCAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8776478-8776795	Sequence	SHJGH_7714 - hypothetical protein (Protein is coded in complementary strand; from 8776795 to 8776478)