Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9090993
End position: 9091016
Length: 24

DNA sequence
>NC_020895, from 9090993 to 9091016 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGTCGCCTTCGCCGGCACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9090709-9091563	Sequence	SHJGH_7957 - 20S proteasome beta-subunit