Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9206613
End position: 9206636
Length: 24

DNA sequence
>NC_020895, from 9206613 to 9206636 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGCACCAGCTCCGGCACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9206359-9207837	Sequence	SHJGH_8066 - putative glutamate-cysteine ligase (Protein is coded in complementary strand; from 9207837 to 9206359)