Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9744173
End position: 9744196
Length: 24

DNA sequence
>NC_020895, from 9744173 to 9744196 (24 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGCGACGGCGCCGGCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9743744-9744298	Sequence	SHJGH_8554 - membrane protein (Protein is coded in complementary strand; from 9744298 to 9743744)