Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2683145
End position: 2683169
Length: 25

DNA sequence
>NC_020895, from 2683145 to 2683169 (25 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGCGTGGCGGTGCGCGGCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2682646-2685084	Sequence	SHJGH_2250 - putative sporulation protein K-like protein