Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2740297
End position: 2740321
Length: 25

DNA sequence
>NC_020895, from 2740297 to 2740321 (25 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGGCGGGTCGGGCCGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2740279-2741025	Sequence	SHJGH_2306 - hypothetical protein (Protein is coded in complementary strand; from 2741025 to 2740279)