Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4452362
End position: 4452386
Length: 25

DNA sequence
>NC_020895, from 4452362 to 4452386 (25 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGGGGCGGGCCGGGTCGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4451970-4453721	Sequence	SHJGH_3898 - hypothetical protein (Protein is coded in complementary strand; from 4453721 to 4451970)