Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9130980
End position: 9131004
Length: 25

DNA sequence
>NC_020895, from 9130980 to 9131004 (25 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTGCGGGGCGGAGCGGTGAGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9130975-9131382	Sequence	SHJGH_7994 - hypothetical protein (Protein is coded in complementary strand; from 9131382 to 9130975)