Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9131735
End position: 9131759
Length: 25

DNA sequence
>NC_020895, from 9131735 to 9131759 (25 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCGCGGTGCGGTGCCGCGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9131379-9133196	Sequence	SHJGH_7995 - putative sensor histidine-kinase (Protein is coded in complementary strand; from 9133196 to 9131379)