Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2189881
End position: 2189907
Length: 27

DNA sequence
>NC_020895, from 2189881 to 2189907 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGCCCTTCTCGCCCTTCTCGCCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2189722-2190315	Sequence	SHJGH_1805 - membrane protein (Protein is coded in complementary strand; from 2190315 to 2189722)