Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2336745
End position: 2336771
Length: 27

DNA sequence
>NC_020895, from 2336745 to 2336771 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGACACAACTGACACACCTGACACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2336338-2336904	Sequence	SHJGH_1946 - hypothetical protein (Protein is coded in complementary strand; from 2336904 to 2336338)