Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2865464
End position: 2865490
Length: 27

DNA sequence
>NC_020895, from 2865464 to 2865490 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CATCCCGGACATCCCGGACATCCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2865243-2865887	Sequence	SHJGH_2423 - putative lipoprotein (Protein is coded in complementary strand; from 2865887 to 2865243)