Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2898544
End position: 2898570
Length: 27

DNA sequence
>NC_020895, from 2898544 to 2898570 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGCTGCTGGCGCCGCTGCCGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2898123-2899277	Sequence	SHJGH_2461 - two-component system sensor kinase