Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3243523
End position: 3243549
Length: 27

DNA sequence
>NC_020895, from 3243523 to 3243549 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCTGGTTGCCCTGGTTGCCCTGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3242331-3243557	Sequence	SHJGH_2774 - acetylornithine aminotransferase (Protein is coded in complementary strand; from 3243557 to 3242331)