Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3722486
End position: 3722512
Length: 27

DNA sequence
>NC_020895, from 3722486 to 3722512 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTCCGCGCCGCCCGCGCCGTCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3722475-3723119	Sequence	SHJGH_3230 - dephospho-CoA kinase (Protein is coded in complementary strand; from 3723119 to 3722475)