Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3882072
End position: 3882098
Length: 27

DNA sequence
>NC_020895, from 3882072 to 3882098 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGCCTTCGCCGCCTTCTCGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3882030-3882806	Sequence	SHJGH_3370 - 1-acylglycerol-3-phosphate O-acyltransferase (Protein is coded in complementary strand; from 3882806 to 3882030)