Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4380019
End position: 4380045
Length: 27

DNA sequence
>NC_020895, from 4380019 to 4380045 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TTGGCGAGGTCGGCGAGGTTGGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4379611-4381365	Sequence	SHJGH_3838 - hypothetical protein (Protein is coded in complementary strand; from 4381365 to 4379611)