Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4384381
End position: 4384407
Length: 27

DNA sequence
>NC_020895, from 4384381 to 4384407 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTGGTCGAACTGGTCGAGCTGGTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4383911-4384981	Sequence	SHJGH_3843 - hypothetical protein (Protein is coded in complementary strand; from 4384981 to 4383911)