Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4426128
End position: 4426154
Length: 27

DNA sequence
>NC_020895, from 4426128 to 4426154 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCGGTGGCCGTGGTGGCCGCCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4425812-4426771	Sequence	SHJGH_3874 - hypothetical protein