Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4499322
End position: 4499348
Length: 27

DNA sequence
>NC_020895, from 4499322 to 4499348 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGTCCCGGCGGTCCCGGCGGCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4498676-4500232	Sequence	SHJGH_3941 - hypothetical protein