Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4800294
End position: 4800320
Length: 27

DNA sequence
>NC_020895, from 4800294 to 4800320 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTGCGGCTGCTGGGGCTGCTGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4800011-4801735	Sequence	SHJGH_4207 - serine/threonine protein kinase (Protein is coded in complementary strand; from 4801735 to 4800011)