Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4950996
End position: 4951022
Length: 27

DNA sequence
>NC_020895, from 4950996 to 4951022 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCACCGCTGTCACCGCTGTCACCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4950957-4951535	Sequence	SHJGH_4325 - hypothetical protein (Protein is coded in complementary strand; from 4951535 to 4950957)