Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4956570
End position: 4956596
Length: 27

DNA sequence
>NC_020895, from 4956570 to 4956596 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCGGAGCCGCCCGAGCCACCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4955916-4957007	Sequence	SHJGH_4330 - putative secreted protein (Protein is coded in complementary strand; from 4957007 to 4955916)