Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5019076
End position: 5019102
Length: 27

DNA sequence
>NC_020895, from 5019076 to 5019102 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCTCGAACGCCTCGAAAGCCTCGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5017932-5019305	Sequence	SHJGH_4383 - hypothetical protein (Protein is coded in complementary strand; from 5019305 to 5017932)