Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5475533
End position: 5475559
Length: 27

DNA sequence
>NC_020895, from 5475533 to 5475559 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGGCGAAGGCGGCCAAGGCGGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5474974-5475567	Sequence	SHJGH_4801 - hypothetical protein