Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 558295
End position: 558321
Length: 27

DNA sequence
>NC_020895, from 558295 to 558321 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGCGGGGTGGACGGGGTGGACGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 558104-559609	Sequence	SHJGH_0458 - hypothetical protein (Protein is coded in complementary strand; from 559609 to 558104)