Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5899965
End position: 5899991
Length: 27

DNA sequence
>NC_020895, from 5899965 to 5899991 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGGGAGCCGGGGGAGTCAGGGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5899703-5902948	Sequence	SHJGH_5187 - LuxR-family transcriptional regulator (Protein is coded in complementary strand; from 5902948 to 5899703)