Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 605856
End position: 605882
Length: 27

DNA sequence
>NC_020895, from 605856 to 605882 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGTCGTCCTCGTCGTCCTCGTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 604023-606338	Sequence	SHJGH_0498 - hypothetical protein (Protein is coded in complementary strand; from 606338 to 604023)