Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6366400
End position: 6366426
Length: 27

DNA sequence
>NC_020895, from 6366400 to 6366426 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACCAGGTCAACCAGGTCGACCTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6366146-6367651	Sequence	SHJGH_5629 - inosine 5' monophosphate dehydrogenase