Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6407982
End position: 6408008
Length: 27

DNA sequence
>NC_020895, from 6407982 to 6408008 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGAGTTGCCGGAGTTGCCGGAGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6407887-6409419	Sequence	SHJGH_5662 - peptidase (Protein is coded in complementary strand; from 6409419 to 6407887)