Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6418736
End position: 6418762
Length: 27

DNA sequence
>NC_020895, from 6418736 to 6418762 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCAGGTCAGGCAGGTCAGGCAGGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6418693-6418914	Sequence	SHJGH_5670 - hypothetical protein (Protein is coded in complementary strand; from 6418914 to 6418693)