Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6648111
End position: 6648137
Length: 27

DNA sequence
>NC_020895, from 6648111 to 6648137 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGTCCTGCGTGCCCTGCGTGTCCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6648095-6648601	Sequence	SHJGH_5865 - hypothetical protein (Protein is coded in complementary strand; from 6648601 to 6648095)