Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6649869
End position: 6649895
Length: 27

DNA sequence
>NC_020895, from 6649869 to 6649895 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGGGGCCGCCGGGACCGTCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6648723-6650441	Sequence	SHJGH_5866 - chinitase A precursor (Protein is coded in complementary strand; from 6650441 to 6648723)