Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6825667
End position: 6825693
Length: 27

DNA sequence
>NC_020895, from 6825667 to 6825693 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACGGCCACCGCGGCCACCACGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6824118-6827096	Sequence	SHJGH_6029 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 6827096 to 6824118)